Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_102683/hsa_circ_0007386 | |||
Gene | CRIM1 | Organism | Human |
Genome Locus | chr2:36668400-36669878:+ | Build | hg19 |
Disease | Thoracic Aortic Dissection | ICD-10 | Injury of thoracic aorta (S25.0) |
DBLink | Link to database | PMID | 29137225 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Aortic segments between human type A Thoracic Aortic Dissection (TAD) patients (n=3) and age-matched normal donors (NA; n=3) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CAGGACAACGTGGAGAGAACTG ReverseAGACTAACTGCAGATGGTTGCTGTAC | Statistics | Fold Change : Downregulated,2.459 pvalue : p<0.05 |
Citation | |||
Zou, M, Huang, C, Li, X, He, X, Chen, Y, Liao, W, Liao, Y, Sun, J, Liu, Z, Zhong, L, Bin, J (2017). Circular RNA expression profile and potential function of hsa_circRNA_101238 in human thoracic aortic dissection. Oncotarget, 8, 47:81825-81837. |